Chst10 antibody thermo
WebFeb 2, 2013 · A Chst10 targeting vector was constructed as shown in Fig. 1. Homologously recombined ES clones were selected by Southern hybridization using a probe adjacent to the targeting vector. Probe DNA (about 450 bp) was amplified by PCR using the following primers: 5–12s, TGTAGTCAAGGCAGCAACCAAGCA, and 5–13a, … WebThere are currently no images for Carbohydrate Sulfotransferase 10/CHST10 Antibody (NBP2-97238IR). Every product we sell is backed by Novus' 100% Guarantee . If you …
Chst10 antibody thermo
Did you know?
WebCHST10 Antibody (PA5-106630) in ICC/IF. Immunofluorescent analysis of CHST10 in HUVEC cell lysate. Samples were fixed with paraformaldehyde, permeabilized with 0.1% …
WebImmunohistochemical analysis of paraffin-embedded human gliomas using 12013-1-AP (CHST10 antibody) at dilution of 1:50 (under 10x lens). View All Images (2) Save time and replace your secondary antibodies with our FlexAble Antibody Labeling Kits $389 / 150 μL Cat No. 12013-1-AP In stock. WebType Antibody Immunogen A synthetic peptide derived from the internal region of human CHST10 Conjugate Unconjugated Form Liquid Concentration 1mg/ml Purification …
WebBest Art Classes in Fawn Creek Township, KS - Elaine Wilson Art, Tallgrass Art Gallery, Bevs Ceramic Shed, MillieArt WebRabbit Polyclonal CHST10 antibody Internal Region for ELISA, ICC, IF, IHC, WB. Order anti-CHST10 antibody ABIN6258961. language English local_shipping United States phone+1 877 302 8632; Contact; person Login favorite_border Comparison List shopping_cart Basket menu; north; arrow_back. search. search. Phone: +1 877 302 …
WebHNK-1ST/CHST10 antibodies are validated with different applications, which are IHC-P. HNK-1ST/CHST10 cDNA Clone (13) HNK-1ST/CHST10 cDNA clones are full length sequence confirmed and expression validated. There are 13 kinds of tags for each HNK-1ST/CHST10 of different species, especially GFP tag, OFP tag, FLAG tag and so on. …
WebAntibodies. Protein structure ... CHST10 is part of cluster 22 Rhabdoid cancers - Neuronal signaling with confidence i 1 291 genes in cluster Go to interactive expression cluster page. 15 nearest neighbours based on cell line RNA expression. Neighbour i. Description i. ... earthbound wiki fandomWebCHST10, Rabbit, Monoclonal Antibody, Abnova™-Rabbit monoclonal antibody raised against a human CHST10 peptide using ARM Technology. Fisher Scientific Fisher Healthcare cte in scalar functionWebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG ... Conjugate Unconjugated Immunogen A synthesized peptide derived from human CHST10, corresponding to a region within the internal amino acids. Form Liquid Concentration 1mg/mL Purification Affinity … cte in professional football playersWebFawn Creek Township is a locality in Kansas. Fawn Creek Township is situated nearby to the village Dearing and the hamlet Jefferson. Map. Directions. Satellite. Photo Map. earthbound wiki pooWebRabbit polyclonal antibody raised against synthetic peptide of CHST10.IgGy Antibody Selector – Quickly search hundreds of thousands of antibodies available for … cte in sas proc sqlWebWe offer a wide range of validated CHST10 antibodies. Order online or by email, fax, or phone. ️ Low Prices ️ 100% Guarantee ️ FREE Shipping earthbound wiki lucasWebA superior strategy for validation of antibody: Blocking peptide validation; Independent Antibody Verification; phospho-antibody made by Affinity; Fruit fly studies guide investigators to misregulated mechanism in human cancers; G Protein-Coupled Receptors (GPCRs) win 2012 Nobel Prize in Chemistry cte in rugby vs football